View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2574_low_15 (Length: 247)
Name: NF2574_low_15
Description: NF2574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2574_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 8 - 224
Target Start/End: Complemental strand, 1696824 - 1696605
Alignment:
| Q |
8 |
gtagattattctgcatgcatatcaactatttactaagtacatttcatcaatacccttattgatgagcatgcatatcaatatcatgca--tttgtgtaaga |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
1696824 |
gtagattattctgcatgcatatcaactatttactaagtacatttcatcaatacccttattgatgagcatgcat------atcatgcaggtttgtgtaaga |
1696731 |
T |
 |
| Q |
106 |
aaatgcttataaggccaaaaattaacagtttcaagcaggtttgtgtt-------nnnnnnnnnnctcatttttcaagcagatcagtggtcatgtaagaac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1696730 |
aaatgcttataaggccaaaaattaacagtttcaagcaggtttgtgttaaaaaaaataaaaaaaactcatttttcaagcagatcagtggtcatgtaagaac |
1696631 |
T |
 |
| Q |
199 |
tagtaatggctatctaatgttatggc |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1696630 |
cagtaatggctatctaatgttatggc |
1696605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University