View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2574_low_16 (Length: 234)
Name: NF2574_low_16
Description: NF2574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2574_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 23598114 - 23598328
Alignment:
| Q |
1 |
aaattcgtgttt-atctttctaagttgggtagtttttgttaggattataatcggttaagaaatttgaagtgaatagacttcttcaattttggttttggtt |
99 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23598114 |
aaattcgtgttttatctttctaagttgggtagtttttgttaggattataatcagttaagaaatttgaagtgaatagacttcttcaattttggttttggtt |
23598213 |
T |
|
| Q |
100 |
tggcttttaaaactgtagcaggttggtgttcgagggcatactagaaaaagattaaaaaatggctcaattgactttgttggttttggtttggcttttgaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23598214 |
tggcttttaaaactgtagcaggttggtgttcgagggcatactagaaaaagattaaaaaatggctcaattgactttgttggttttggtttggcttttgaaa |
23598313 |
T |
|
| Q |
200 |
ctgtatcaggttggt |
214 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
23598314 |
ctgtatcaggttggt |
23598328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University