View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2574_low_6 (Length: 358)
Name: NF2574_low_6
Description: NF2574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2574_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 43089158 - 43089498
Alignment:
| Q |
1 |
ctccaaaatctgaaattgatgtattgcttcttctagaccttgattttggtcttccagtatcaacttctactatttttggacttccaatatcataactgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089158 |
ctccaaaatctgaaattgatgtattgcttcttctagaccttgattttggtcttccagtatcaacttctactatttttggacttccaatatcataactgtt |
43089257 |
T |
 |
| Q |
101 |
cattgtagcatcaaaagatgatgataatcttctgctgtgaataggaattgaagctgtaaactcgttcctgttactctcattgtgattgtacctttcctgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43089258 |
cattgtagcatcaaaagatgatgataatcttctgctgtgaataggaattgaagctgtgtactcgttcctgttactctcattgtgattatacctttcctgc |
43089357 |
T |
 |
| Q |
201 |
aaaataaaaatcataagaaatgtaaatattcaagtgatactaggaattagaatatgagatctgtttatgtattttaccgtggatcttctagcttgtgttt |
300 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089358 |
aaaataacaatcataagaaatgtaaatattcaagtgatactaggaattaaaatatgagatctgtttatgtattttaccgtggatcttctagcttgtgttt |
43089457 |
T |
 |
| Q |
301 |
gaaatctgttatttgtttcattctttgtgtttatgatgagt |
341 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43089458 |
gaaatctgttatttgtttcattctttgtgcttatgatgagt |
43089498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University