View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2575_high_4 (Length: 246)
Name: NF2575_high_4
Description: NF2575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2575_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 6080494 - 6080289
Alignment:
| Q |
19 |
aaagggggagagatggggaggggaaagtgtcggtttggcagtatttgcatcttactactgtgtcatgtttgaatcaacaacatgtgtcatttgaccaagt |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6080494 |
aaagggggagagatagggaggggaaagtgtcggtttggctgtatttgcatcatactactgtgtcatgtttgaatcaaca---tgtgtcatttgaccaagt |
6080398 |
T |
|
| Q |
119 |
agaacacaagacactcatctaccaccagtttatgtaccctggaccttaagtaactacgcaaccatcacatgcttaaaatttaatgatactgtcatactac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6080397 |
agaacacaagacactcatctaccaccagtttatgtaccctggaccttaagtaactacgcaaccatcacatgcttaaaatttaatgatactgtcatactac |
6080298 |
T |
|
| Q |
219 |
tactactag |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
6080297 |
tactactag |
6080289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University