View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2576_high_7 (Length: 227)
Name: NF2576_high_7
Description: NF2576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2576_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 11 - 210
Target Start/End: Complemental strand, 42895440 - 42895238
Alignment:
| Q |
11 |
attattcttgcatttatgtgatttaaatggtcttaatagaatggccannnnnnnnncaatgcttggaactacccaacccaacccactctctataccatcc |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42895440 |
attactcttgcatttatgtgatttaaatggtcttaatagaatggccatttttttttcaatgcttggaactacccaacccaacccactctctataccatcc |
42895341 |
T |
|
| Q |
111 |
attgttttgtagttttactcatcctcctcct---aacacaatcaaattttcttatactatacgacatacaactttcacgttattgctctcattatactcg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42895340 |
tttgttttgtagttttactcatcctcctcctcctaacacaatcaaattttcttatactatacgacatacaactttcacgttattgttctcattatactcg |
42895241 |
T |
|
| Q |
208 |
tgg |
210 |
Q |
| |
|
||| |
|
|
| T |
42895240 |
tgg |
42895238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 50
Target Start/End: Original strand, 25581412 - 25581451
Alignment:
| Q |
11 |
attattcttgcatttatgtgatttaaatggtcttaataga |
50 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25581412 |
attactcttgcatttatgtgatttaaatggtcttaataga |
25581451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University