View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2576_low_3 (Length: 329)
Name: NF2576_low_3
Description: NF2576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2576_low_3 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 57 - 329
Target Start/End: Complemental strand, 40518143 - 40517871
Alignment:
| Q |
57 |
atattatcatttaatttaatactaaggtttattgattcaaaagtaaaaactagcttgtacataatataaaactcgtctcatttgtacatcatcgaattca |
156 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518143 |
atattatcatttaatttaatagtaaggtttattgattcaaaagtaaaaactagcttgtacataatataaaactcgtctcatttgtacatcatcgaattca |
40518044 |
T |
 |
| Q |
157 |
tcatgtatgcatatataattgcttggcaaatacccctnnnnnnnttgcttggcaaattaattgttaaacctttcagctagttaaaaaggccacccataac |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518043 |
tcatgtatgcatatataattgcttggcaaatacccctaaaaaaattgcttgccaaattaattgttaaacctttcagctagttaaaaaggccacccataac |
40517944 |
T |
 |
| Q |
257 |
ataaccaattccaaacaaattaaaattcacattccaaattttggtcgagaagatgaacatcaacaacaacggc |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40517943 |
ataaccaattccaaacaaattaaaattcacattccaaattttggtcgagaagatgaacatcgacaacaacggc |
40517871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 40518243 - 40518203
Alignment:
| Q |
18 |
aaactatgtaagcttggtctaacattcataactaaaatgat |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518243 |
aaactatgtaagcttggtctaacattcataactaaaatgat |
40518203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University