View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2577_high_14 (Length: 240)
Name: NF2577_high_14
Description: NF2577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2577_high_14 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 86 - 240
Target Start/End: Complemental strand, 15378643 - 15378489
Alignment:
| Q |
86 |
gttttcatggaaactcaattttccatgtactccgcgacccaccaattaaattagatataaaattatggttaatttagttgagtatatggttaaacgtgtt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15378643 |
gttttcatggaaactcaattttccatgtactccgcgacccaccaattaaattagatataaaattatggttaatttagttgagtatatggttaaacgtgtt |
15378544 |
T |
 |
| Q |
186 |
taaaattgtaaaattatagttaatcaagaagttgaattacttaaattttgatcca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
15378543 |
taaaattgtaaaattatagttaatcaagaagttaaattagttaaattttgatcca |
15378489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 15378728 - 15378685
Alignment:
| Q |
1 |
ttatagaactagacgtaaataagtaagtacagtgaatcctgtcg |
44 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
15378728 |
ttatagaacaagacgtaaataagtaagtacggtgaatcctgtcg |
15378685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University