View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2577_high_22 (Length: 220)
Name: NF2577_high_22
Description: NF2577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2577_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 123 - 218
Target Start/End: Original strand, 39231074 - 39231169
Alignment:
| Q |
123 |
gttggatcttgaagcttgaacttgttcaagaaaccggttttgttgccatgcaatcatttgttctgcaggttcgttaattcttcattatgttattct |
218 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231074 |
gttggatcttgtagcttgaacttgttcaagaaaccggttttgttaccatgcaatcatttgttctgcaggttcgttaattcttcattatgttattct |
39231169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 39230947 - 39231010
Alignment:
| Q |
1 |
catggatgcttcattttcaaaaactcgctctcgaactcaaatgccctctctggttcgtattcac |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39230947 |
catggatgcttcattttcaaaaactcgctctcgaactcaaatgccctctctggtatgtattcac |
39231010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University