View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2577_high_22 (Length: 220)

Name: NF2577_high_22
Description: NF2577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2577_high_22
NF2577_high_22
[»] chr7 (2 HSPs)
chr7 (123-218)||(39231074-39231169)
chr7 (1-64)||(39230947-39231010)


Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 123 - 218
Target Start/End: Original strand, 39231074 - 39231169
Alignment:
123 gttggatcttgaagcttgaacttgttcaagaaaccggttttgttgccatgcaatcatttgttctgcaggttcgttaattcttcattatgttattct 218  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
39231074 gttggatcttgtagcttgaacttgttcaagaaaccggttttgttaccatgcaatcatttgttctgcaggttcgttaattcttcattatgttattct 39231169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 39230947 - 39231010
Alignment:
1 catggatgcttcattttcaaaaactcgctctcgaactcaaatgccctctctggttcgtattcac 64  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||    
39230947 catggatgcttcattttcaaaaactcgctctcgaactcaaatgccctctctggtatgtattcac 39231010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University