View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2577_low_14 (Length: 250)

Name: NF2577_low_14
Description: NF2577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2577_low_14
NF2577_low_14
[»] chr5 (1 HSPs)
chr5 (1-209)||(2264790-2264997)


Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 2264790 - 2264997
Alignment:
1 tatcaatagaatattattagtgcagagtcaaattgttgtatctttctttgtaataccagataactaaaggaaaatcaaacagtcaaactaattaattaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2264790 tatcaatagaatattattagtgcagagtcaaattgttgtatctttctttgtaataccagataactaaaggaaaatcaaacagtcaaactaattaattaaa 2264889  T
101 ttaacttaaactatgcaaaatacaaaatctgttttcatataaagctttgcttgagacatggaatggaagtgtcaaaccttcaacgagaagcaatacaaat 200  Q
    ||||||||||||||||||||||||||||||  ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2264890 ttaacttaaactatgcaaaatacaaaatctcctttcatataaagc-ttgcttgagacatggaatggaagtgtcaaaccttcaacgagaagcaatacaaat 2264988  T
201 aattcttta 209  Q
    |||||||||    
2264989 aattcttta 2264997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University