View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2577_low_6 (Length: 361)
Name: NF2577_low_6
Description: NF2577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2577_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 7 - 346
Target Start/End: Original strand, 10084691 - 10085030
Alignment:
| Q |
7 |
taacaatgagatgaatttataaaatttggaggaccatggaacttgcatgtccctcttctccatccgcccatgcaaggaagctttggttagaggatctaaa |
106 |
Q |
| |
|
||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10084691 |
taacactgaaatgaatttataaaacttggaggaccatggaacttgcatgtccctcttctccatccgcccatgcaaggaagctttggttagaggatctaaa |
10084790 |
T |
 |
| Q |
107 |
agaaatagtataatttttaataactccattgattttgtataactagtatttgattaattaagtttcactttcggtctcatattgtggcaaaattaggagc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10084791 |
agaaatagtataatttttaataactccattgattttgtataactagtatttgattaattaagtttcactttcggtctcatattgtggcaaaattaggagc |
10084890 |
T |
 |
| Q |
207 |
ttttggtttaccaattgtgtatttgcaagaccttattatattattccttagaaaagtaatggtgcttggtgagtcttacgctcaaacttttcaagcttta |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10084891 |
ttttggtttaccaattgtgtatttgcaagaccttattatattattccttagaaaagtaatggtgcttggtgagtcttacgctcaaacttttcaagcttta |
10084990 |
T |
 |
| Q |
307 |
tgtattgtagggtaaaaatgaagaaaggaaatgcaaaagc |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10084991 |
tgtattgtagggtaaaaatgaagaaaggaaatgcaaaagc |
10085030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University