View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2578_high_10 (Length: 236)
Name: NF2578_high_10
Description: NF2578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2578_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 389375 - 389582
Alignment:
| Q |
1 |
ttgtgtgcgttcaactataagcaatcatttgtttctgtagtagatttgaaatcagaatagaatcagaagaagatgacggttccgatagctatgcagtcga |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
389375 |
ttgtgtgcgttcaactataatcaatcatttgtctctgtagtagatttgaaatcagaa--------------gatgacggttccgatagctatgcagtcga |
389460 |
T |
 |
| Q |
101 |
caccgggaagttcaggttacttagatatgcatcctgatcgtaagatgtctttcttcaaaaatccttacattctcggcctcgctgctgtcgccggtattgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
389461 |
caccgggaagttcaggttacttagatatgcatcctgatcgtaagatgtctttcttcaaaaatccttacattctcggccttgctgctgtcgccggtattgg |
389560 |
T |
 |
| Q |
201 |
tggtcttctcttcggttacgac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
389561 |
tggtcttctcttcggttacgac |
389582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 203
Target Start/End: Complemental strand, 52772699 - 52772627
Alignment:
| Q |
131 |
atcctgatcgtaagatgtctttcttcaaaaatccttacattctcggcctcgctgctgtcgccggtattggtgg |
203 |
Q |
| |
|
||||||| || || |||||||| || || |||||||| || ||||| |||||||||||||| ||||||||||| |
|
|
| T |
52772699 |
atcctgaacgcaaaatgtctttttttaagaatccttatatcctcggtctcgctgctgtcgctggtattggtgg |
52772627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University