View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2579_high_7 (Length: 281)
Name: NF2579_high_7
Description: NF2579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2579_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 52 - 242
Target Start/End: Original strand, 38426709 - 38426899
Alignment:
| Q |
52 |
catcatcaagtaaaaagaatggtatccatcatttgagaaattaccagatgaaagtcagcaaggttgtcaacataagcctctagtcgcttcatatcatgtg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38426709 |
catcatcaagtaaaaagaatggtatccatcatttgagaaattaccagatgaaagtcagcaagattgtcaacataagcctctagtcgcttcatatcatgtg |
38426808 |
T |
 |
| Q |
152 |
gtgataaattttctttaactgatcccaaaaatttgtcagcggttgtcttgataggctcttgctccgtaaaattgatttttgggcctatgat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38426809 |
gtgataaattttctttaactgatcccaaaaatttgtcagcggttgtcttgataggctcttgctccgtaaaattgatttttgggtctatgat |
38426899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University