View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2579_low_16 (Length: 278)
Name: NF2579_low_16
Description: NF2579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2579_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 44130434 - 44130620
Alignment:
| Q |
1 |
agtggagacctagacaggaaaaagttggtaattgttgcttggaagaaatgttgcttaccttacactgaaggaggccttggtttgaggtcaattgtggttt |
100 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44130434 |
agtggagacctatacaagaaaaagttggtaattgttgcttggaagaaatgatgcttaccttactctgaaggaggccttggtttgaggtcaattgtggttt |
44130533 |
T |
 |
| Q |
101 |
taaatgaagcttcggatttgaagatgtgctgggacctttgtaatttagaggagcaatgggccattttgtttagagatagagtgatga |
187 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44130534 |
taaatgaagcttcgaatctgaagatctgctgggacctttgtaattcagaggagcaatgggccattttccttagagatagagtgatga |
44130620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University