View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2579_low_17 (Length: 262)
Name: NF2579_low_17
Description: NF2579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2579_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 28112814 - 28112585
Alignment:
| Q |
1 |
tgtgtctcaaccttataaaatgtgtcagcaacaattttctcctaccattggttctaaacttgttctaatattagttttaaaggtggtccacgactttcaa |
100 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28112814 |
tgtgtctcaaccttatgaaatgtgtcaacaacaattttctcctaccattggttctaaacttgttctaatattagttttataggtggtccacgactttcaa |
28112715 |
T |
|
| Q |
101 |
tatcaccgttaacaagnnnnnnnnnnnnattccttctaaataaatggtatgataggaaccaacgatgtgagtccaaccacattaccttcccactaaattt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
28112714 |
tatcaccgttaacaag--ttttttttttattccttctaaataaatggtatgataggaaccaacgatgtgagtccaaccacattaccttcctaccaaattt |
28112617 |
T |
|
| Q |
201 |
tgatgtgaatttttgtgtcttccatgcaaata |
232 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
28112616 |
tgatgagaatttttgtgtcttccatgcaaata |
28112585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 49857948 - 49857985
Alignment:
| Q |
1 |
tgtgtctcaaccttataaaatgtgtcagcaacaatttt |
38 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49857948 |
tgtgtctcaaccttataaaatgtgtcaacaacaatttt |
49857985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 12690916 - 12690879
Alignment:
| Q |
1 |
tgtgtctcaaccttataaaatgtgtcagcaacaatttt |
38 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
12690916 |
tgtgtctcaatcttataaaatgtgtcaacaacaatttt |
12690879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University