View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2579_low_23 (Length: 232)
Name: NF2579_low_23
Description: NF2579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2579_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 30 - 115
Target Start/End: Original strand, 3215832 - 3215917
Alignment:
| Q |
30 |
agtttttcaacagagcagcaattccgctgagatgtggacaagacattgaggtacctgaaatgatgttgtatggtggtatattgttg |
115 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3215832 |
agtttttcaacagagcagcaattccactgagatgtggacaagacattgaggtacctgaaatgatgttgtatggtggtatattgttg |
3215917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 96
Target Start/End: Original strand, 3207896 - 3207962
Alignment:
| Q |
30 |
agtttttcaacagagcagcaattccgctgagatgtggacaagacattgaggtacctgaaatgatgtt |
96 |
Q |
| |
|
|||||||||||| ||||||||| || || ||||| ||||| |||||||||||||||||||| ||||| |
|
|
| T |
3207896 |
agtttttcaacaaagcagcaatgccactaagatgaggacatgacattgaggtacctgaaattatgtt |
3207962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 96
Target Start/End: Original strand, 3201922 - 3201988
Alignment:
| Q |
30 |
agtttttcaacagagcagcaattccgctgagatgtggacaagacattgaggtacctgaaatgatgtt |
96 |
Q |
| |
|
|||||||||||| ||||||||| || || ||||| ||||||||||| |||||||||| ||| ||||| |
|
|
| T |
3201922 |
agtttttcaacaaagcagcaatgccactaagatgaggacaagacatcgaggtacctgcaattatgtt |
3201988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University