View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2579_low_9 (Length: 367)

Name: NF2579_low_9
Description: NF2579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2579_low_9
NF2579_low_9
[»] chr7 (1 HSPs)
chr7 (145-197)||(25506890-25506942)


Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 25506942 - 25506890
Alignment:
145 cttcatttgcatcagtttcagctgctctaatagttaatcttctctctgcaatg 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
25506942 cttcatttgcatcagtttcagctgctctaatagttaatcttctctctgcaatg 25506890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University