View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_high_31 (Length: 290)
Name: NF2580_high_31
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 13 - 274
Target Start/End: Complemental strand, 47660850 - 47660589
Alignment:
| Q |
13 |
tgagacggtttaatctatcagcatttgggtcggtagagtaataatccatctgttggctgaggatccttgagaattcatcattcatggtataggcaagagc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47660850 |
tgagacggtttaatctatcagcatttgggtcggtagagtaataatccatctgttggctgaggatccttgagaattcatcattcatggtataggcaggagc |
47660751 |
T |
|
| Q |
113 |
tgaaagaattgcaccggcatatgtcttcacaaatctattatgaatatcttcaagaaatgaaaatggaatccttcctgcagtcattcaaacagaacatttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47660750 |
tgaaagaattgcaccggcatatgtcttcacaaatctattatgaatatcttcaagaaatgaaaatggaatccttcctgcagtcattcaaacagaacatttg |
47660651 |
T |
|
| Q |
213 |
ttcaagttcattcaaggatggtaaacaacataatatttggatcataattgtttcattcaatt |
274 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47660650 |
ttcaagttcattcatggatggtaaacaacataatatttggatcataattgtttcattcaatt |
47660589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University