View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2580_high_42 (Length: 250)

Name: NF2580_high_42
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2580_high_42
NF2580_high_42
[»] chr6 (2 HSPs)
chr6 (10-128)||(34532176-34532295)
chr6 (171-250)||(34532054-34532133)


Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 10 - 128
Target Start/End: Complemental strand, 34532295 - 34532176
Alignment:
10 attattctatcttctgcaatgttttgaaattcggaccgaatatggacc-agtgaaacttcaagattatgatttaataggttcaatcagttcaacttcggt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||    
34532295 attattctatcttctgcaatgttttgaaattcggaccgaatatggaactagtgaaacttcaagattatgatttaataggttcaatcagttcaactacggt 34532196  T
109 taaactggatgacagataga 128  Q
    ||||||||| ||||||||||    
34532195 taaactggacgacagataga 34532176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 171 - 250
Target Start/End: Complemental strand, 34532133 - 34532054
Alignment:
171 ctagctacgattaaaccgtagttaagaggtttgacccgattcaatatggttcaaccagactgcaatatagagaaccaacc 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34532133 ctagctacgattaaaccgtagttaagaggtttgacccgattcaatatggttcaaccagactgcaatatagagaaccaacc 34532054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University