View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_high_42 (Length: 250)
Name: NF2580_high_42
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_high_42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 10 - 128
Target Start/End: Complemental strand, 34532295 - 34532176
Alignment:
| Q |
10 |
attattctatcttctgcaatgttttgaaattcggaccgaatatggacc-agtgaaacttcaagattatgatttaataggttcaatcagttcaacttcggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34532295 |
attattctatcttctgcaatgttttgaaattcggaccgaatatggaactagtgaaacttcaagattatgatttaataggttcaatcagttcaactacggt |
34532196 |
T |
 |
| Q |
109 |
taaactggatgacagataga |
128 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
34532195 |
taaactggacgacagataga |
34532176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 171 - 250
Target Start/End: Complemental strand, 34532133 - 34532054
Alignment:
| Q |
171 |
ctagctacgattaaaccgtagttaagaggtttgacccgattcaatatggttcaaccagactgcaatatagagaaccaacc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34532133 |
ctagctacgattaaaccgtagttaagaggtttgacccgattcaatatggttcaaccagactgcaatatagagaaccaacc |
34532054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University