View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_high_45 (Length: 246)
Name: NF2580_high_45
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_high_45 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 13 - 246
Target Start/End: Original strand, 6608811 - 6609045
Alignment:
| Q |
13 |
gagatttcgatcttctagctgttggcttgcaagaagctccgggaaacaaaattgcaactatgctttcggcagctttgaatgaaagtcacacgtaagagtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6608811 |
gagatttcgatcttctagctgttggcttgcaagaagctccgggaaacaaaattgcaactatgctttcggcagctttgaatgaaagtcacacgtaagagtt |
6608910 |
T |
|
| Q |
113 |
catttgtttccatcctaacattgaaaatcagaatcgataataagctct-aagtttgtccagttataagtatatatgtcaagatgttatgctagtgcaggt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6608911 |
catttgtttccatcctaacattgaaaatcagaatcgataataagctctaaagtttgtccagttataagtatatatgtcaagatgttattctagtgcaggt |
6609010 |
T |
|
| Q |
212 |
gcaatagtgcaaccatgattatgctctataatcac |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6609011 |
gcaatagtgcaaccatgattatgctctataatcac |
6609045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University