View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_high_46 (Length: 242)
Name: NF2580_high_46
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_high_46 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 21 - 242
Target Start/End: Original strand, 1792950 - 1793169
Alignment:
| Q |
21 |
gggaccaagtgagattttcaaggcattctgcccaaaaggaatgattccatctacatatccttttgttcnnnnnnn--gttgttcgatgatcttcatatcc |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1792950 |
gggaccaagcgagattttcaaggcattctgcccaaaaggaatgattccatctacatatccttttgttctttttttttgttgttcgatgatcttcatatcc |
1793049 |
T |
 |
| Q |
119 |
tttttgttgtttggaggttttcacttggttttatactagtcgttctatttgcattaatatccaactctaaggtagctcaaacttagccacctatttgaag |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1793050 |
tttttgttgtttggagtttttcacttggttttatactagtcgttctatttgcattaatatccaactctaaagtagctcaaacttagccacctatttgaag |
1793149 |
T |
 |
| Q |
219 |
accaaacaaaagcataataatact |
242 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
1793150 |
ac----taaaagcataataatact |
1793169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University