View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_high_54 (Length: 229)
Name: NF2580_high_54
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 41345457 - 41345397
Alignment:
| Q |
1 |
atcagcaacattgaagattgattagtataccgcatttcttcaattcaaatatattatgcag |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41345457 |
atcagcaacattgaagattgattagtataccgcatttcttcaattcaaatatattatgcag |
41345397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 205
Target Start/End: Complemental strand, 41345281 - 41345252
Alignment:
| Q |
176 |
tcatcatggtcgttgaaatttcaaaactta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41345281 |
tcatcatggtcgttgaaatttcaaaactta |
41345252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University