View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_high_57 (Length: 226)
Name: NF2580_high_57
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_high_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 41469362 - 41469297
Alignment:
| Q |
1 |
taaataaatatcataaaatcaactcaaaagaaattgcaacacaaatagctagtactatgaattaag |
66 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41469362 |
taaataaatatcataaaatgaactcaaaagaaattgcaacacaaatagctagtactatgaattaag |
41469297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 16410207 - 16410249
Alignment:
| Q |
10 |
atcataaaatcaactcaaaagaaattgcaacacaaatagctag |
52 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
16410207 |
atcataaaatcaactccaaagaaattgctacacaaatagctag |
16410249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University