View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_high_58 (Length: 226)
Name: NF2580_high_58
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_high_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 35228197 - 35228417
Alignment:
| Q |
1 |
ccataaccaactatagtcactgtatgatctaaataaattccacattttcctttcaaaattccacttgagtaaaattgaaaatcgcgttttgtcgcggcaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
35228197 |
ccataaccaactatagtaactgtatgatctaaatcaattccacattttcctttcaaaattccacttgagtaaaattgaaaagcgcgttttgtcgcggcga |
35228296 |
T |
 |
| Q |
101 |
tataaaccgctataggttgatttgccaccgcttttaagagcgccttttcattattggcgggaacatgctcatatcccttaattttagcaacattgtaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228297 |
tataaaccgctataggttgatttgccaccgcttttaagagcgccttttcattattggcgggaacatgctcatatcccttaattttagcaacattgtaggt |
35228396 |
T |
 |
| Q |
201 |
tcctttcctaacattgcattt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35228397 |
tcctttcctaacattgcattt |
35228417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University