View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2580_high_9 (Length: 448)

Name: NF2580_high_9
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2580_high_9
NF2580_high_9
[»] chr2 (8 HSPs)
chr2 (12-432)||(41957854-41958281)
chr2 (12-254)||(5598924-5599164)
chr2 (122-192)||(5597488-5597558)
chr2 (318-427)||(37128960-37129071)
chr2 (324-398)||(42048283-42048358)
chr2 (310-429)||(4397465-4397586)
chr2 (324-391)||(9560862-9560930)
chr2 (360-431)||(23665437-23665509)
[»] chr1 (5 HSPs)
chr1 (12-254)||(25548845-25549085)
chr1 (293-429)||(38709863-38709998)
chr1 (285-404)||(39908882-39909000)
chr1 (285-404)||(4391509-4391627)
chr1 (324-404)||(13987560-13987641)
[»] chr8 (7 HSPs)
chr8 (12-230)||(40637167-40637375)
chr8 (122-192)||(40635738-40635808)
chr8 (286-404)||(38387821-38387938)
chr8 (285-404)||(46287-46406)
chr8 (337-432)||(544382-544479)
chr8 (326-421)||(1579079-1579176)
chr8 (327-392)||(40531176-40531242)
[»] chr4 (5 HSPs)
chr4 (285-402)||(1799048-1799164)
chr4 (324-429)||(40813816-40813923)
chr4 (325-429)||(26500310-26500416)
chr4 (296-424)||(37707395-37707523)
chr4 (286-429)||(10388464-10388607)
[»] chr3 (6 HSPs)
chr3 (310-429)||(16284991-16285112)
chr3 (285-432)||(45181496-45181643)
chr3 (324-404)||(2782130-2782211)
chr3 (285-429)||(17324192-17324336)
chr3 (342-404)||(3968611-3968674)
chr3 (342-404)||(4000131-4000194)
[»] chr5 (4 HSPs)
chr5 (285-429)||(35846999-35847144)
chr5 (291-429)||(42742371-42742508)
chr5 (353-429)||(39368831-39368908)
chr5 (334-424)||(18557486-18557577)
[»] chr7 (4 HSPs)
chr7 (324-429)||(27993571-27993678)
chr7 (353-432)||(6003343-6003423)
chr7 (285-429)||(2570062-2570206)
chr7 (324-429)||(46262154-46262261)
[»] chr6 (1 HSPs)
chr6 (324-432)||(7546461-7546571)


Alignment Details
Target: chr2 (Bit Score: 317; Significance: 1e-179; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 12 - 432
Target Start/End: Original strand, 41957854 - 41958281
Alignment:
12 gaagggtaaaattggaattgatcagatggcggagagtgtggaggtgctgaggcagcttcgcgtgctgattttgtaagacaagaaaagtgaaagtcaaaat 111  Q
    ||||||||||||| ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41957854 gaagggtaaaatttgaattgatcagatggcggag--tgtggaggtgctgaggcagcttcgcgtgctgattttgtaagacaagaaaagtgaaagtcaaaat 41957951  T
112 ctatacctagagctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttgtcggataacggatttgtcggt 211  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
41957952 ctatacctagagctagaggtgttcatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttgtcacataacggatttgtcggt 41958051  T
212 tgaaactcacaaatgca--------acatctcatgcagtattactttcggttcgctttgcgctaatgttctaccnnnnnnngtcttgggattttggcatc 303  Q
    |||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||       ||||| |||||||||||||    
41958052 tgaaactcacaaatgcaacccgttgacatctcatgcagtattactttcggttcgctttgcgctaatgttctacctttctctgtcttcggattttggcatc 41958151  T
304 tggttatattgatgggttgggtttttggataggttaaagtgtctgctct-gtggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgt 402  Q
     ||||||||||||||||||| |||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||    
41958152 gggttatattgatgggttggatttttggacaggttaaggtgtctgctctggtggtttgtgagttgaagggtgcctttttgacttgtgtcaggagtcttgt 41958251  T
403 ggccgtccacttttgattcgaggtcggaag 432  Q
    ||||| ||||||||||||||||||||||||    
41958252 ggccgaccacttttgattcgaggtcggaag 41958281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 12 - 254
Target Start/End: Original strand, 5598924 - 5599164
Alignment:
12 gaagggtaaaattggaattgatcagatggcggagagtgtggaggtgctgaggcagcttcgcgtgctgattttgtaagacaagaaaagtgaaagtcaaaat 111  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5598924 gaagggtaaaattggaattgatcagatggcggagagtgtcgaggtgctgaggcagcttcgcgtgctgattttgtaagacaagaaaagtgaaagtcaaaat 5599023  T
112 ctatacctagagctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttgtcggataacggatttgtcggt 211  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||    
5599024 ctatacctagagctagaggtgttcatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttgtc----------tttgtcggt 5599113  T
212 tgaaactcacaaatgca--------acatctcatgcagtattactttcggt 254  Q
    |||||||||||||||||        ||||||||||||||||||||||||||    
5599114 tgaaactcacaaatgcaaccagttgacatctcatgcagtattactttcggt 5599164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 122 - 192
Target Start/End: Complemental strand, 5597558 - 5597488
Alignment:
122 agctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttgtc 192  Q
    ||||||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||| ||||||||    
5597558 agctagaggtgttcatgtgtacgggtcaaatatgaacacagttgcacaaacgacccaaaccgacatttgtc 5597488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 318 - 427
Target Start/End: Complemental strand, 37129071 - 37128960
Alignment:
318 ggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgt-ggccgtccacttt 415  Q
    ||||| ||||||||| ||||| | |||||||||||| ||||| |||||||||  ||||||||||||| |||||| ||||||||||| |||||  | ||||    
37129071 ggttgagtttttggacaggttcaggtgtctgctctggtggttcgtgagttgataggtgcctttttgacttgtgttaggagtcttgtgggccgatcgcttt 37128972  T
416 tgattcgaggtc 427  Q
    ||||||||||||    
37128971 tgattcgaggtc 37128960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 324 - 398
Target Start/End: Complemental strand, 42048358 - 42048283
Alignment:
324 gtttttggataggttaaagtgtctgctct-gtggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtc 398  Q
    ||||||||| | ||||| ||||||||||| |||||| |||||||||  |||||||| ||||||| |||| ||||||    
42048358 gtttttggacatgttaaggtgtctgctctggtggttcgtgagttgagaggtgccttgttgatttctgtcgggagtc 42048283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 310 - 429
Target Start/End: Complemental strand, 4397586 - 4397465
Alignment:
310 tattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgtggcc-g 407  Q
    ||||| ||||| | ||||||||| | ||| | ||||||||| || ||||| ||||||||| ||||||| |||||| || | || |||||||||||| | |    
4397586 tattggtgggtcgagtttttggacaagtttatgtgtctgctatggtggttcgtgagttgaggggtgccattttgacttctctcgggagtcttgtgggctg 4397487  T
408 tccacttttgattcgaggtcgg 429  Q
      | ||||||||||||||||||    
4397486 atcgcttttgattcgaggtcgg 4397465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 324 - 391
Target Start/End: Complemental strand, 9560930 - 9560862
Alignment:
324 gtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtc 391  Q
    ||||||||||| ||||  |||||||||||| | ||| ||||||||| |||||||||  |||||||||||    
9560930 gtttttggataagttatggtgtctgctctggtagttcgtgagttgaggggtgccttgatgatttgtgtc 9560862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 431
Target Start/End: Complemental strand, 23665509 - 23665437
Alignment:
360 gtgagttgaagggtgcctttttgatttgtgtcaggagtcttgtgg-ccgtccacttttgattcgaggtcggaa 431  Q
    ||||||||| ||||||| |||| |||||| || ||||||| |||| |||  ||||||||||||||| ||||||    
23665509 gtgagttgaggggtgccatttttatttgtatcgggagtctagtgggccgatcacttttgattcgagatcggaa 23665437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 12 - 254
Target Start/End: Original strand, 25548845 - 25549085
Alignment:
12 gaagggtaaaattggaattgatcagatggcggagagtgtggaggtgctgaggcagcttcgcgtgctgattttgtaagacaagaaaagtgaaagtcaaaat 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25548845 gaagggtaaaattggaattgatcagatggcggagagtgtggaggtgctgaggcagcttcgcgtgctgattttgtaagacaagaaaagtgaaagtcaaaat 25548944  T
112 ctatacctagagctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttgtcggataacggatttgtcggt 211  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||          |||||||||    
25548945 ctatacctagagctagaggtgttcatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaatcggcatttgtc----------tttgtcggt 25549034  T
212 tgaaactcacaaatgca--------acatctcatgcagtattactttcggt 254  Q
    |||||||||||||||||        ||||||||||||||||||||||||||    
25549035 tgaaactcacaaatgcaacccgttgacatctcatgcagtattactttcggt 25549085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 293 - 429
Target Start/End: Original strand, 38709863 - 38709998
Alignment:
293 attttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtc 391  Q
    ||||||||||| ||||||  || ||||| | ||||||||| ||||||| |||| || |||| ||||| ||||||||| |||||||||||||  |||| ||    
38709863 attttggcatcgggttat--tggtgggtcgagtttttggacaggttaaggtgtttgttctggtggttcgtgagttgaggggtgcctttttgccttgtttc 38709960  T
392 aggagtcttgtggccgtccacttttgattcgaggtcgg 429  Q
     ||||||||  ||| |  | ||||||||||||||||||    
38709961 gggagtctttgggctgatcgcttttgattcgaggtcgg 38709998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 285 - 404
Target Start/End: Complemental strand, 39909000 - 39908882
Alignment:
285 gtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttga 383  Q
    ||||| ||||||||||||| ||||||  || ||| | | ||||||||| ||||| | |||| ||||||| ||||| ||||||||| |||||| |||||||    
39909000 gtctttggattttggcatcgggttat--tggtggatcgagtttttggacaggtttaggtgtatgctctggtggttcgtgagttgaggggtgcttttttga 39908903  T
384 tttgtgtcaggagtcttgtgg 404  Q
     |||||||  |||||||||||    
39908902 cttgtgtcgtgagtcttgtgg 39908882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 285 - 404
Target Start/End: Original strand, 4391509 - 4391627
Alignment:
285 gtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttga 383  Q
    ||||| ||||||||||||| |||| |  || ||||| | | ||||||  ||||||| ||||||| |||| ||||| ||||||||| |||||| ||||||     
4391509 gtctttggattttggcatcgggttct--tggtgggtcgaggttttggtcaggttaaggtgtctgttctggtggttcgtgagttgaggggtgcatttttgc 4391606  T
384 tttgtgtcaggagtcttgtgg 404  Q
     ||||||| ||||||||||||    
4391607 cttgtgtcgggagtcttgtgg 4391627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 324 - 404
Target Start/End: Original strand, 13987560 - 13987641
Alignment:
324 gtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgtgg 404  Q
    |||||| ||||||||   |||||||||||| ||||| ||||||||| |||||||||  ||||||||||| ||| ||| ||||    
13987560 gtttttagataggttttggtgtctgctctggtggttcgtgagttgaggggtgccttgatgatttgtgtcgggaatctggtgg 13987641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 172; Significance: 3e-92; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 12 - 230
Target Start/End: Original strand, 40637167 - 40637375
Alignment:
12 gaagggtaaaattggaattgatcagatggcggagagtgtggaggtgctgaggcagcttcgcgtgctgattttgtaagacaagaaaagtgaaagtcaaaat 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40637167 gaagggtaaaattggaattgatcagatggcggagagtgtggaggtgctgaggcagcttcgcgtgctgattttgtaagacaagaaaagtgaaagtcaaaat 40637266  T
112 ctatacctagagctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttgtcggataacggatttgtcggt 211  Q
     |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||    
40637267 ttatacctagagctagaggtgttcatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccgtcatttgtc----------tttgtcggt 40637356  T
212 tgaaactcacaaatgcaac 230  Q
    |||||||||||||||||||    
40637357 tgaaactcacaaatgcaac 40637375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 122 - 192
Target Start/End: Complemental strand, 40635808 - 40635738
Alignment:
122 agctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttgtc 192  Q
    ||||||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||| ||||||||    
40635808 agctagaggtgttcatgtgtacgggtcaaatatgaacacagttgcacaaacgacccaaaccgacatttgtc 40635738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 286 - 404
Target Start/End: Original strand, 38387821 - 38387938
Alignment:
286 tcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgat 384  Q
    |||| |||||||| |||| ||||||  || ||||| | ||||||||| ||||||| |||| ||||||| ||||| ||||||||| ||||||||||||||     
38387821 tctttggattttgccatcaggttat--tggtgggtcgagtttttggacaggttaaggtgtttgctctggtggttcgtgagttgaggggtgcctttttgac 38387918  T
385 ttgtgtcaggagtcttgtgg 404  Q
    || |||| ||||||||||||    
38387919 ttatgtcgggagtcttgtgg 38387938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 285 - 404
Target Start/End: Complemental strand, 46406 - 46287
Alignment:
285 gtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctgt--ggtttgtgagttgaagggtgcctttttg 382  Q
    ||||| |||||||| |||| ||||||  || ||||| | ||||||||| ||||| | |||||||||| |   |||| ||||||||| |||||||||||||    
46406 gtctttggattttgacatcgggttat--tggtgggtcgagtttttggacaggtttatgtgtctgctccggtgggttcgtgagttgaggggtgcctttttg 46309  T
383 atttgtgtcaggagtcttgtgg 404  Q
    | ||||||| ||||||||||||    
46308 acttgtgtcgggagtcttgtgg 46287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 337 - 432
Target Start/End: Complemental strand, 544479 - 544382
Alignment:
337 ttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgt-ggccgtccacttttgattcgaggtcggaag 432  Q
    |||| |||||||||||| ||| ||||||||||| || |||| |||||||||||||| ||||||| || || ||  |||||| |||||||| |||||||    
544479 ttaaggtgtctgctctggtggattgtgagttgacggatgccgttttgatttgtgtcgggagtctggtgggtcgatcactttagattcgagatcggaag 544382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 326 - 421
Target Start/End: Original strand, 1579079 - 1579176
Alignment:
326 ttttggataggttaaagtgtctgctct-gtggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgt-ggccgtccacttttgattc 421  Q
    ||||||||||||| | ||||||||||| |||||| ||||||||| || ||||| ||| | ||||||  |||||||||| |||||  ||||||||||||    
1579079 ttttggataggtttaggtgtctgctctggtggttcgtgagttgagggatgcctcttttacttgtgttgggagtcttgtgggccgatcacttttgattc 1579176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 327 - 392
Target Start/End: Original strand, 40531176 - 40531242
Alignment:
327 tttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtca 392  Q
    |||||| ||||||| |||||||||||| ||| |  |||||||| ||||||| |||||||||||||||    
40531176 tttggacaggttaaggtgtctgctctggtgggtcttgagttgaggggtgccgttttgatttgtgtca 40531242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 56; Significance: 5e-23; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 285 - 402
Target Start/End: Original strand, 1799048 - 1799164
Alignment:
285 gtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttga 383  Q
    ||||| ||||||||||||| ||||||  || ||||| | ||||||||||||||||| |||||||||| | ||||| ||||||||| ||||||||||||||    
1799048 gtctttggattttggcatcgggttat--tggtgggtcgagtttttggataggttaaggtgtctgctccggtggttcgtgagttgaggggtgcctttttga 1799145  T
384 tttgtgtcaggagtcttgt 402  Q
     |||||| |||||||||||    
1799146 cttgtgtaaggagtcttgt 1799164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 324 - 429
Target Start/End: Complemental strand, 40813923 - 40813816
Alignment:
324 gtttttggataggttaaagtgtctgctct-gtggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgt-ggccgtccacttttgattc 421  Q
    ||||||||||||||||| ||||||||||| |||||| |||| ||||||||||||||| ||||||| ||| ||||||| || |||||  ||||||||||||    
40813923 gtttttggataggttaaggtgtctgctctagtggttcgtgaattgaagggtgcctttatgatttgcgtcgggagtctggtgggccgatcacttttgattc 40813824  T
422 gaggtcgg 429  Q
    ||| ||||    
40813823 gagatcgg 40813816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 325 - 429
Target Start/End: Complemental strand, 26500416 - 26500310
Alignment:
325 tttttggataggttaaagtgtctgctct-gtggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgtggc-cgtccacttttgattcg 422  Q
    |||||||| ||||||| |||| |||||| |||||| ||||||||| |||||||||||||| ||||||| | ||||||||||  ||  | |||||||||||    
26500416 tttttggacaggttaaggtgtatgctctagtggttcgtgagttgaggggtgcctttttgacttgtgtcggaagtcttgtgggtcgatcgcttttgattcg 26500317  T
423 aggtcgg 429  Q
    |||||||    
26500316 aggtcgg 26500310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 424
Target Start/End: Complemental strand, 37707523 - 37707395
Alignment:
296 ttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcagg 394  Q
    ||||||||||||| |  || ||||| | |||||||||||| ||   |||||||||||| ||||| ||||||||| ||||||||||||| | |||||| ||    
37707523 ttggcatctggtttt--tggtgggtcgagtttttggatagattttggtgtctgctctggtggttcgtgagttgaggggtgcctttttgctatgtgtcggg 37707426  T
395 agtcttgt-ggccgtccacttttgattcgag 424  Q
    ||||| || |||||  |||||||||||||||    
37707425 agtctggtgggccgatcacttttgattcgag 37707395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 286 - 429
Target Start/End: Original strand, 10388464 - 10388607
Alignment:
286 tcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctct-gtggtttgtgagttgaagggtgcctttttgat 384  Q
    |||| ||||||||||||| ||||||  ||||||||   ||||| ||| | || || ||||||||||| ||| || ||||||||| || || ||||||||     
10388464 tctttggattttggcatcgggttat--tgatgggtcaagttttgggacatgtaaaggtgtctgctctagtgcttcgtgagttgagggatgtctttttgac 10388561  T
385 ttgtgtcaggagtcttgtgg-ccgtccacttttgattcgaggtcgg 429  Q
    ||| |||  ||||||||||| |||  ||||||||||||||||||||    
10388562 ttgcgtcgagagtcttgtgggccgatcacttttgattcgaggtcgg 10388607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 54; Significance: 7e-22; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 429
Target Start/End: Original strand, 16284991 - 16285112
Alignment:
310 tattgatgggttgggtttttggataggttaaagtgtctgctct-gtggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgt-ggccg 407  Q
    ||||| ||||| | ||||||||| ||||||| ||||||||||| |||||| ||||||||| |||||||||||||| | ||||| |||||||||| |||||    
16284991 tattggtgggtcgagtttttggacaggttaaggtgtctgctcttgtggttcgtgagttgaggggtgcctttttgactagtgtctggagtcttgtgggccg 16285090  T
408 tccacttttgattcgaggtcgg 429  Q
      | ||||||||||||||||||    
16285091 atcgcttttgattcgaggtcgg 16285112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 285 - 432
Target Start/End: Original strand, 45181496 - 45181643
Alignment:
285 gtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttga 383  Q
    ||||| ||||||||||||  ||||||  || ||||| | ||||||||| ||||||  |||||||||||| ||||| ||||||||| ||||||||||||||    
45181496 gtctttggattttggcattgggttat--tggtgggtcgagtttttggacaggttagggtgtctgctctggtggttcgtgagttgaggggtgcctttttga 45181593  T
384 tttgtgtcaggagtcttgtgg-ccgtccacttttgattcgaggtcggaag 432  Q
     || |||| |||||||||||| ||   | |||||||||||||||||||||    
45181594 cttttgtcgggagtcttgtgggccaatcgcttttgattcgaggtcggaag 45181643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 324 - 404
Target Start/End: Complemental strand, 2782211 - 2782130
Alignment:
324 gtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgtgg 404  Q
    ||||||||| ||||||| |||||||||||| ||||||||||||||| |||||||||  |||||||||||  |||||| ||||    
2782211 gtttttggacaggttaaggtgtctgctctggtggtttgtgagttgaggggtgccttaatgatttgtgtcgagagtctggtgg 2782130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 285 - 429
Target Start/End: Complemental strand, 17324336 - 17324192
Alignment:
285 gtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttga 383  Q
    ||||| |||||||| |||| ||||||  || ||||| | ||||||||||||||| | |||||| ||| | ||||| ||||||||| |||||||||||| |    
17324336 gtctttggattttgacatcgggttat--tggtgggtcgagtttttggataggtttaggtgtctactccggtggttcgtgagttgaggggtgcctttttta 17324239  T
384 tttgtgtcaggagtcttgt-ggccgtccacttttgattcgaggtcgg 429  Q
     || ||||  ||||||||| |||||  | ||||||||||||||||||    
17324238 cttatgtcgtgagtcttgtgggccgatctcttttgattcgaggtcgg 17324192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 404
Target Start/End: Complemental strand, 3968674 - 3968611
Alignment:
342 gtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgtgg 404  Q
    |||||||||||| ||||| ||||||||| |||||||||  ||||||||||| ||||||| ||||    
3968674 gtgtctgctctggtggttcgtgagttgaggggtgccttgatgatttgtgtcgggagtctggtgg 3968611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 404
Target Start/End: Original strand, 4000131 - 4000194
Alignment:
342 gtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgtgg 404  Q
    |||||||||||| ||||| ||||||||| |||||||||  ||||||||||| ||||||| ||||    
4000131 gtgtctgctctggtggttcgtgagttgaggggtgccttgatgatttgtgtcgggagtctggtgg 4000194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 285 - 429
Target Start/End: Original strand, 35846999 - 35847144
Alignment:
285 gtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcc-tttttg 382  Q
    ||||| ||||||||||||| ||||||  || |||||   ||||||||| | ||||| |||||||||||| ||||||||||||||| ||||||| ||||||    
35846999 gtctttggattttggcatcgggttat--tggtgggtcaagtttttggacatgttaaggtgtctgctctggtggtttgtgagttgatgggtgccttttttg 35847096  T
383 atttgtgtcaggagtcttgt-ggccgtccacttttgattcgaggtcgg 429  Q
    | ||||||| ||||| |||| |||||  |  |||||||||||||||||    
35847097 acttgtgtcgggagttttgtgggccgatcgattttgattcgaggtcgg 35847144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 291 - 429
Target Start/End: Complemental strand, 42742508 - 42742371
Alignment:
291 ggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtg 389  Q
    ||||||||||||| ||||||  || |||||   ||||||| | ||||| | |||||||||||| ||||| ||| ||||  |||||||||||||| |||||    
42742508 ggattttggcatcgggttat--tggtgggtcaagtttttgaacaggtttaggtgtctgctctggtggttcgtgggttgtggggtgcctttttgacttgtg 42742411  T
390 tcaggagtcttgtggccgtccacttttgattcgaggtcgg 429  Q
    || |||||||||||| ||  | ||||||||||||||||||    
42742410 tcgggagtcttgtgggcgatcgcttttgattcgaggtcgg 42742371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 353 - 429
Target Start/End: Original strand, 39368831 - 39368908
Alignment:
353 gtggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgt-ggccgtccacttttgattcgaggtcgg 429  Q
    |||||| |||||||||  |||| |||||||| ||||||| |||||||||| ||||| || ||||||||||||||||||    
39368831 gtggttcgtgagttgagaggtgtctttttgacttgtgtcgggagtcttgtgggccgaccgcttttgattcgaggtcgg 39368908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 334 - 424
Target Start/End: Original strand, 18557486 - 18557577
Alignment:
334 aggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgtggccgtccacttttgattcgag 424  Q
    ||||||| |||||| ||||| ||| | ||||||||| ||||||| |||||||||||||| |||||||   |||||  |||||||||||||||    
18557486 aggttaaggtgtctactctggtgggtcgtgagttgaggggtgccgttttgatttgtgtcgggagtctatgggccgatcacttttgattcgag 18557577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 44; Significance: 7e-16; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 324 - 429
Target Start/End: Complemental strand, 27993678 - 27993571
Alignment:
324 gtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgtgg-ccgtccacttttgattc 421  Q
    ||||||||||||||||  |||| ||||||| ||||| ||||||||| ||||| |||| ||||||||||| ||||||| |||| |||  ||||||||||||    
27993678 gtttttggataggttatggtgtttgctctggtggttcgtgagttgaggggtgtctttatgatttgtgtcgggagtctggtggaccgatcacttttgattc 27993579  T
422 gaggtcgg 429  Q
    ||| ||||    
27993578 gagatcgg 27993571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 432
Target Start/End: Original strand, 6003343 - 6003423
Alignment:
353 gtggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgt-ggccgtccacttttgattcgaggtcggaag 432  Q
    ||||||||||| ||||  | |||||||||||||||||||||||||||| | |||||  | |||||||||||||||||||||    
6003343 gtggtttgtgaattgagtgatgcctttttgatttgtgtcaggagtcttatgggccgatcgcttttgattcgaggtcggaag 6003423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 285 - 429
Target Start/End: Original strand, 2570062 - 2570206
Alignment:
285 gtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttga 383  Q
    ||||| ||||||||||||| ||||||  || ||||| | | ||||||  || |||| |||| ||||||| | | | ||||||||| ||||||||||||||    
2570062 gtctttggattttggcatcgggttat--tggtgggtcgaggttttggtcagattaaggtgtttgctctggttgctcgtgagttgaggggtgcctttttga 2570159  T
384 tttgtgtcaggagtcttgtggccgt-ccacttttgattcgaggtcgg 429  Q
     ||||||||||||||| |||| | |  | ||||||||||||||||||    
2570160 cttgtgtcaggagtctggtgggcttatcgcttttgattcgaggtcgg 2570206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 324 - 429
Target Start/End: Complemental strand, 46262261 - 46262154
Alignment:
324 gtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgt-ggccgtccacttttgattc 421  Q
    |||||||||||| |||  |||||| ||| | || || ||||||||| |||||||||||||||| ||||  ||||||| || |||||  ||||||||||||    
46262261 gtttttggatagtttatggtgtcttctccggtgattcgtgagttgaggggtgcctttttgattggtgttgggagtctggtgggccgatcacttttgattc 46262162  T
422 gaggtcgg 429  Q
    ||| ||||    
46262161 gagatcgg 46262154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 324 - 432
Target Start/End: Complemental strand, 7546571 - 7546461
Alignment:
324 gtttttggataggttaaagtgtctgctctg-tggtttgtgagttgaagggtgcctttttgatttgtgtcaggagtcttgtgg-ccgtccacttttgattc 421  Q
    ||||||||||||||||  |||||||||||| ||||| ||||||||| |||||||||||| ||| ||||   |||||| |||| |||  ||||||||||||    
7546571 gtttttggataggttatggtgtctgctctggtggttcgtgagttgaggggtgccttttttattggtgttgagagtctggtggaccgatcacttttgattc 7546472  T
422 gaggtcggaag 432  Q
    ||| |||||||    
7546471 gagatcggaag 7546461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University