View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_low_15 (Length: 383)
Name: NF2580_low_15
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 12 - 351
Target Start/End: Complemental strand, 30295958 - 30295621
Alignment:
| Q |
12 |
atgaacgatcttattgctttggccggctgtgtcatctttatgttttactaatttcttctatcaatacaaaatcattgtcacatttctctctcacacacac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30295958 |
atgaacgatcttattgctttggccggctgtgtcatctttatgttttactaatttcttctatcaatacaaaatcattgtcacatttctctctcacacaca- |
30295860 |
T |
|
| Q |
112 |
agtttatggctgatgatgctgattatcaacctttgttcgataccaaatttggtgtgatactaattgccatgggttcagctagctttgtggttacaatata |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30295859 |
-gtttatggctgatgatgctgattatcaacctttgttcgataccaaatttggtgtgatactaattgccatgggttcagctagctttgtggttacaatata |
30295761 |
T |
|
| Q |
212 |
ccatctcatattcatttgctgcaaacacgcatccgaacaagcgcggcagcatgagcaaccagcaacacaaacgccgagcacggaagaaggaagtttggtg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30295760 |
ccatctcatattcatttgctgcaaacacgcatccgaacaagcgcggcagcatgagcaaccagcaacacaaacgctgagcacggaagaaggaagtttggtg |
30295661 |
T |
|
| Q |
312 |
tcacatcagattccatcctacaagtatgagaagaaaagga |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30295660 |
tcacatcagattccatcctacaagtatgagaagaaaagga |
30295621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University