View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_low_24 (Length: 352)
Name: NF2580_low_24
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 138 - 351
Target Start/End: Original strand, 47661397 - 47661608
Alignment:
| Q |
138 |
gaccaataatgtatactgggtcaaagaaaaaagaaatattcatacttgtatttattgggatgcaatgttaccgttttaggatagtgcacgttttagaaaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47661397 |
gaccaataatgtatactgggtcaaagaaaaaagaaatattcatacttgtatttattgggatgcaatgttaccgttttaggctagtgcacgttttagaaaa |
47661496 |
T |
 |
| Q |
238 |
atgttacgcaatgtggatgagtttgcattgcaagataccctattgtatgggtatatttacaattctaaaggaacactgtaattttttccctattgttccc |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
47661497 |
ttgttacgcaatgtggatgagtttgcattgcaagataccctattgtatgggtatatttacaattctgaaggaacac--taattttttccctattgttccc |
47661594 |
T |
 |
| Q |
338 |
ttcatctctctcga |
351 |
Q |
| |
|
||||| || ||||| |
|
|
| T |
47661595 |
ttcatttcactcga |
47661608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 3 - 109
Target Start/End: Original strand, 47661262 - 47661368
Alignment:
| Q |
3 |
cactcattatgatttttgccatcgtcttttacattttactcgcatttatgcgtcatggtccttttctgacttcgtgttggagataagctctcaaggctaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47661262 |
cactcattatgatttttgccatcgtcttttacattatactcgcatttatgtgtcatggtccttttctgacttcgtgttggagataagctctcaaggctaa |
47661361 |
T |
 |
| Q |
103 |
ctgtaaa |
109 |
Q |
| |
|
||||||| |
|
|
| T |
47661362 |
ctgtaaa |
47661368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University