View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_low_35 (Length: 283)
Name: NF2580_low_35
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 9054961 - 9055231
Alignment:
| Q |
1 |
ttgtttatttagttagataattttgaaattaggaagtgtttggaaagtcttagaggttaatttagtttgtataatcatcggtatttaagatttaaaggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9054961 |
ttgtttatttagttagataattttgaaattaggaagtgtttggaaagtcttggaggttaatttagtttgtataatcatcggtatttaagatttaaaggat |
9055060 |
T |
 |
| Q |
101 |
atggaacataggtgtaaattagttttgcaccgaatagaaattatgttctcgtagctacattttaaaagtggtgatatgatatgacaaaatagcggactca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9055061 |
atggaacataggtgtaaattagttttgcaccgaatagaaattatgttctcgtagctacattttaaaagtggtgatatgatatgacaaaatagcagactca |
9055160 |
T |
 |
| Q |
201 |
tattggatatcagacgtgtaaaactacttaactacactggcaggcagtgtatgctcattaaactcgtgttc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9055161 |
tattggatatcagacgtgtaaaactacttaactacactggcaggcagtgtatgctcattaaactcgtgttc |
9055231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University