View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2580_low_52 (Length: 237)
Name: NF2580_low_52
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2580_low_52 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 20 - 108
Target Start/End: Original strand, 25520388 - 25520476
Alignment:
| Q |
20 |
aatctcaatatatttaccatgatgaaataattgagctgttccacttcaatctctgtcagtgatgcttgtctcttagttatgtttgtctt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25520388 |
aatctcaatatatttaccatgatgaaataattgagctgttccacttcaatctctgtcagtgatgcttgtctcttagttatgtttgtctt |
25520476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 161 - 221
Target Start/End: Original strand, 25520554 - 25520614
Alignment:
| Q |
161 |
tagaaatataaaacaattaggacgagtttacacgtatgttataaatatcaaacaatgatga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25520554 |
tagaaatataaaacaattaggacgagtttacacgtatgttataaatatcaaacaatgatga |
25520614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 42133433 - 42133356
Alignment:
| Q |
24 |
tcaatatatttaccatgatgaaataattgagctgttccacttcaatctctgtcagtgatgcttgtctcttagttatgtttgtcttg |
109 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42133433 |
tcaatatactaaccatgatgaaataattgagctgttcta--------tctgtttgtgatgcttgtctcttagttatgtttgtcttg |
42133356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University