View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2580_low_60 (Length: 226)

Name: NF2580_low_60
Description: NF2580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2580_low_60
NF2580_low_60
[»] chr2 (1 HSPs)
chr2 (1-66)||(41469297-41469362)
[»] chr4 (1 HSPs)
chr4 (10-52)||(16410207-16410249)


Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 41469362 - 41469297
Alignment:
1 taaataaatatcataaaatcaactcaaaagaaattgcaacacaaatagctagtactatgaattaag 66  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
41469362 taaataaatatcataaaatgaactcaaaagaaattgcaacacaaatagctagtactatgaattaag 41469297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 16410207 - 16410249
Alignment:
10 atcataaaatcaactcaaaagaaattgcaacacaaatagctag 52  Q
    |||||||||||||||| ||||||||||| ||||||||||||||    
16410207 atcataaaatcaactccaaagaaattgctacacaaatagctag 16410249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University