View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2581_high_6 (Length: 290)
Name: NF2581_high_6
Description: NF2581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2581_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 159 - 278
Target Start/End: Complemental strand, 5827975 - 5827856
Alignment:
| Q |
159 |
caggggaaatatgaagataataagttattgggcctatatttctaatattgtagagtatgtttaggttttgctatatattttattgcaactctagttttct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5827975 |
caggggaaatatgaagataataagttattgggcctatatttctaatattgtagagtatgtttaggttttgctatatattttattgcaactctagttttct |
5827876 |
T |
 |
| Q |
259 |
tatgttatggttttgatatt |
278 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5827875 |
tatgttatggttttgatatt |
5827856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 19 - 106
Target Start/End: Complemental strand, 5828197 - 5828109
Alignment:
| Q |
19 |
tcttcagtatgattgttt-tctctttatattggttcttatgtttgattgatcttatccttattgatttcttctatttaactctctctct |
106 |
Q |
| |
|
||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5828197 |
tcttcagcatgattgcttctctctttatattggttcttatgtttgattgatcttatccttattgatttcttctatttaactcactctct |
5828109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University