View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2581_low_11 (Length: 232)
Name: NF2581_low_11
Description: NF2581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2581_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 11 - 211
Target Start/End: Original strand, 32461658 - 32461864
Alignment:
| Q |
11 |
ataatactaaatagattatacaattgaaaagaaatgatataacattgaaaattaaatatgacaaatattttgatataatannnnnnnnnnnnnnnagaag |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
32461658 |
ataataataaatagattatacaattgaaaagaaatgatataacattgaaaattaaatatgacaattattttgatataata-tttttttcttttttagaag |
32461756 |
T |
 |
| Q |
111 |
aggatgtcatgtgcctacctaatattaacttttacaattttgatgtttgag-------ataatagatgttgtggtcttgtttacctctcttgtagacttc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32461757 |
aggatgtcatgtgcctacctaatattaacttttacaattttgatgtttgagacatgtcataatagatgttgtggtcttgtttacctctcttgtagacttc |
32461856 |
T |
 |
| Q |
204 |
cacaccac |
211 |
Q |
| |
|
|||||||| |
|
|
| T |
32461857 |
cacaccac |
32461864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University