View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2581_low_9 (Length: 249)
Name: NF2581_low_9
Description: NF2581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2581_low_9 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 7422685 - 7422922
Alignment:
| Q |
12 |
aattctacagcttcaaattcggtttcaagagagtagacttaaaattggatttgtattggtttgttcattgaagagcttggtaatttcactgagcttgtag |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
7422685 |
aattctacagattcaaattcggtttcaagagagtagacttaaaattggatttgtgttggtttgttcattgaagagcttggaaatctcactgagcttgtag |
7422784 |
T |
 |
| Q |
112 |
atttggatatgtcagtgaacatttacttgaactatcccttcttctatttgtagccttccatcctaagtttcaaatgcaattaaaaacttaacaacactta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7422785 |
atttggatatgtcagtgaacatttacttgaactatcccttcttctatttgtagccttccatcctaagtttcaaaagcaattaaaaacttaacaacactta |
7422884 |
T |
 |
| Q |
212 |
gaatgttgtctccttacggcgatttctaggacagttct |
249 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7422885 |
gaatgttgtctccttacggcgatatctaggacagttct |
7422922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 79 - 170
Target Start/End: Original strand, 7408996 - 7409086
Alignment:
| Q |
79 |
ttgaagagcttggtaatttcactgagcttgtagatttggatatgtcagtgaacatttacttgaactatcccttcttctatttgtagccttcc |
170 |
Q |
| |
|
||||||||||||| ||| ||| |||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7408996 |
ttgaagagcttggaaatctca-tgagctagtagatttggatatgtcagtgaacatatacttgaactatcccttcttctatttgtagccttcc |
7409086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University