View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2583R-Insertion-1 (Length: 139)
Name: NF2583R-Insertion-1
Description: NF2583R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2583R-Insertion-1 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 2e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 2e-68
Query Start/End: Original strand, 9 - 139
Target Start/End: Complemental strand, 33988618 - 33988488
Alignment:
| Q |
9 |
aatatcggcttctcattacatgtgtgacagccttgtcccatgcatgtaagaaacaaatttgcaactagtcaaattgcaagttacgaaagatttatgtatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33988618 |
aatatcggcttctcattacatgtgtgacagccttgtcccatgcatgtaagaaacaaatttgcaactagtcaaattgcaagttacgaaagatttatgtatc |
33988519 |
T |
 |
| Q |
109 |
atccaccatatttactgttgtagaattgata |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33988518 |
atccaccatatttactgttgtagaattgata |
33988488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University