View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2583R-Insertion-6 (Length: 270)
Name: NF2583R-Insertion-6
Description: NF2583R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2583R-Insertion-6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 9567426 - 9567661
Alignment:
| Q |
12 |
ggtgtccaccgtggaccgatagttgcgaattgatcaagaaatcgacgacaaccaatatcatcattttttagtagaagttcaaggtccttacgttctcatg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9567426 |
ggtgtccaccgtggaccgatagttgcgaattgatcaagaaatcgacgacaaccaatatcgtcattttttagtagaagttcaaggtccttacgttctcatg |
9567525 |
T |
|
| Q |
112 |
gatgagacagtgacatgatatgggttgattcaacaaaatcaagagaaaaccgatataaggttgagctttgaaccagcaccaattgagttgtcgtctcagt |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9567526 |
gatgagacagtgacatgata-gggttgattcaacaaaatcaagagaaaaccgatataaggttgagctttgaaccagcaccaattgagttgtcgtctcagt |
9567624 |
T |
|
| Q |
212 |
catgaggatgagatgaataatatcac-aggttctgct |
247 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9567625 |
catgaggatgagatgaataatatcacaaggttctgct |
9567661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University