View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2583R-Insertion-9 (Length: 400)
Name: NF2583R-Insertion-9
Description: NF2583R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2583R-Insertion-9 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 13 - 399
Target Start/End: Original strand, 343203 - 343591
Alignment:
| Q |
13 |
ggagatgccaccacggttggtggttgtgtcgtgaccggtgttattgccgtcggggttgtaggtggcaactttgttggtgcagttgctggtgcttggacgt |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
343203 |
ggagatgccaccacggtaggtggttgtgtcgtgaccggtgttattgccgtcggggttgtaggtggcaactttgttggtgcagttgctggtgcttgggcgt |
343302 |
T |
 |
| Q |
113 |
tgaatcctagcaggcaactgaggcttagtaaagtcataacccagaacattgtagccattgttgtgtgtaaattgttttgttagagacaa--gagaaaatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | ||||||||| |
|
|
| T |
343303 |
tgaatcctagcaggcaactgaggcttagtaaagtcataacccagaacattgtagccattgttgtgtgtgaattgttttgttagagagagacgagaaaatt |
343402 |
T |
 |
| Q |
211 |
tgtttcttatttattggctatattgtcaagcagatgggtagaaacgtatgtagtggattatctgtggaaggaggaaagtcgccttcatttgattgtgaca |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
343403 |
tgtttcttatttattggctatattgtcaagcagatgggtagaaacgtatgcagtggatcatctgtggaaggaggaaagtagccttcatttgattgtgaca |
343502 |
T |
 |
| Q |
311 |
ttattcattgtcattgatcatctaacaaggaacgttagctaatggaaaatgtgtaggtaacctagcttcgtaaaatcagtggtctttag |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
343503 |
ttattcattgtcattgatcatctaacaaggaacgttagctaatggaaaatgtgtaggtaacctagcttcgtaaaatcaatggtctttag |
343591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University