View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2583_low_3 (Length: 444)
Name: NF2583_low_3
Description: NF2583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2583_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 2e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 171 - 326
Target Start/End: Original strand, 11611905 - 11612061
Alignment:
| Q |
171 |
tattcaaactaaacaaggaccctcatccctagatnnnnnnnnn-ttatgcaatcttgataatgacttatgcagctgacacacacacatattaagaaagag |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11611905 |
tattcaaactaaacaaggaccctcatccctagataaaaaaaaaattatgcaatcttgataatgacttatgcaactgacacacacacatattaagaaagag |
11612004 |
T |
 |
| Q |
270 |
nnnnnnncagacactcacaacaaacatagcatagcaaaacactattcaacattcatg |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612005 |
aaaaaaacagacactcacaacaaacatagcatagcaaaacactattcaacattcatg |
11612061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 92 - 138
Target Start/End: Original strand, 11611833 - 11611879
Alignment:
| Q |
92 |
tgccagtgagtaaagcatatagctaaactctatcctacagcatcttt |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11611833 |
tgccagtgagtaaagcatatagctaaactctatcctacagcatcttt |
11611879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University