View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2584_high_13 (Length: 274)
Name: NF2584_high_13
Description: NF2584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2584_high_13 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 14560996 - 14561262
Alignment:
| Q |
1 |
catatgtggaagtatgttgcctttacctggtgagagtccaaaatatgctcaactatacatatttgatacggagaatgaaatttcaaatagaatgaaaacc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14560996 |
catatttggaagtatgttgcctttacctggtgagagtccaaaatatgctcaactatacatatttgatacggagaatgaaatttcaaatagaatgaaaacc |
14561095 |
T |
|
| Q |
101 |
tacaggtacaacatacacatgtttattactaatttttaaaaatttcattggagaataaaatttcatattgcttatgattaatataaattttgtggttata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14561096 |
tacaggtacaacatacacatgtttattactaatttttaaaaatttcattggagaataaaatttcatattgcttatgattaatataaattttgtggttata |
14561195 |
T |
|
| Q |
201 |
tagatcaaacaaagagattgatgaagatattgtgaagagactcaaggttatgccagaccagaataat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14561196 |
tagatcaaacaaagagattgatgaagatattgtgaagagactcaaggttatgccagaccagaataat |
14561262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 96
Target Start/End: Complemental strand, 153367 - 153278
Alignment:
| Q |
7 |
tggaagtatgttgcctttacctggtgagagtccaaaatatgctcaactatacatatttgatacggagaatgaaatttcaaatagaatgaa |
96 |
Q |
| |
|
||||||| |||||||||| || || || ||||| ||||||||||| |||||||| || || || || |||||||| |||||| ||||||| |
|
|
| T |
153367 |
tggaagtctgttgcctttgccaggggatagtcctaaatatgctcagctatacattttcgacactgataatgaaatatcaaatcgaatgaa |
153278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 96
Target Start/End: Complemental strand, 18065696 - 18065607
Alignment:
| Q |
7 |
tggaagtatgttgcctttacctggtgagagtccaaaatatgctcaactatacatatttgatacggagaatgaaatttcaaatagaatgaa |
96 |
Q |
| |
|
||||||| |||||||||| || || || ||||| ||||||||||| |||||||| || || || || |||||||| |||||| ||||||| |
|
|
| T |
18065696 |
tggaagtctgttgcctttgccaggggatagtcctaaatatgctcagctatacattttcgacactgataatgaaatatcaaatcgaatgaa |
18065607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 95
Target Start/End: Complemental strand, 126685 - 126597
Alignment:
| Q |
7 |
tggaagtatgttgcctttacctggtgagagtccaaaatatgctcaactatacatatttgatacggagaatgaaatttcaaatagaatga |
95 |
Q |
| |
|
|||||| ||||| || ||||| ||| | || ||||||||||||||||||||||| ||||| | || ||||| ||||| |||||||||| |
|
|
| T |
126685 |
tggaagcatgttaccattaccaggtcaaagaccaaaatatgctcaactatacatttttgacatagaaaatgagatttctaatagaatga |
126597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University