View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2584_high_14 (Length: 267)
Name: NF2584_high_14
Description: NF2584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2584_high_14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 1150564 - 1150830
Alignment:
| Q |
1 |
tttaagatgcattttaggtttcggtgtttgatgatcatatcccatttcatcaccgccaaaatcatcagcacttcccaacaacctactcttagcaactaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1150564 |
tttaagatgcattttaggtttcggtgtttgatgatcatatcccatttcatcaccaccaaaatcatcagcacttcccaacaacctactcttagcaactaaa |
1150663 |
T |
 |
| Q |
101 |
ccgtctttcctttgatgagactccgccctctgacgctcctcttcgcgtttagtagcagcaactaacacgctgtaaaaatcacgattcttacactcgagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1150664 |
ccgtctttcctttgatgagactccgccctctgacgctcctcttctcgtttagtagcagcaactaacacgctgtaaaaatcacgattcttacactcgagta |
1150763 |
T |
 |
| Q |
201 |
aagattcacgatccttgagtggcttctcagctgttctaatcattgatatgaaatccaacggcggtga |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1150764 |
aagattcacgatccttgagtggcttctcagctgttctaatcattgatatgaaatccaacggtggtga |
1150830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University