View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2584_high_16 (Length: 253)
Name: NF2584_high_16
Description: NF2584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2584_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 30859892 - 30859635
Alignment:
| Q |
1 |
aagacaattaagaggctggagtggattttcaaatatggttcaaataggttccgagttccgcaatcacaatgatcatctaaatgttcaagtaaccgaaatc |
100 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
30859892 |
aagacaatcaagaggctggaatggattttcaaatatggttcaaataggttccgagttccgcagtcccaatgatcatctaaatgttcaagtaactgaaatc |
30859793 |
T |
|
| Q |
101 |
aaatctctggatgcagcagatccttgtcatataagtctcacaagtgctggtgagtgaaatttgatttggatga------------cttatttcata---c |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| | | ||| | |
|
|
| T |
30859792 |
aaatctctggatgcagcagatccttgtcatataagtctcacaagtgctggtaagtgaaatttgatttggatgattcgtcatacatcttttgttataatgc |
30859693 |
T |
|
| Q |
186 |
ctttgtcattgtctcttgtggtttagttattttcagaatgacttatttcatacctttg |
243 |
Q |
| |
|
| || ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30859692 |
ttatgccattgtctcttgtggtttagttaatttcagaatgacttatttcatacctttg |
30859635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University