View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2584_low_13 (Length: 307)
Name: NF2584_low_13
Description: NF2584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2584_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 17 - 155
Target Start/End: Complemental strand, 33184698 - 33184560
Alignment:
| Q |
17 |
agcatatttgtccttcaaatcgagctaatcatattaattgttcaaagaagaacaattgaagttgcccttcaaatcgattaccagagtaaattttatctta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
33184698 |
agcatatttgtccttcaaatcgagctaattatattaactgttcaaagaagaacaactgaagttgcccttcaaattgattacgagagtaaattttatctta |
33184599 |
T |
 |
| Q |
117 |
ttcgagcaaaacatatttgattgttcgtaaattaacccc |
155 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
33184598 |
ttcgagaaaaacatatttgattgttcgtaaataaacccc |
33184560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 219 - 301
Target Start/End: Complemental strand, 33184496 - 33184414
Alignment:
| Q |
219 |
gtgaaattcctaacacctaggactaccaaaacgacatcaaatggcgtgttgcatgccatgtcacacacttaacattcatctca |
301 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33184496 |
gtgaaattcctaacacctaggactatcaaaacgacatcaaatggtgtgttgcatgccatgtcacacatttaacattcatctca |
33184414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 284
Target Start/End: Complemental strand, 50417873 - 50417825
Alignment:
| Q |
236 |
taggactaccaaaacgacatcaaatggcgtgttgcatgccatgtcacac |
284 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
50417873 |
taggactaccaaaacgacatcaaatgatgtgttttatgccatgtcacac |
50417825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University