View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_high_28 (Length: 368)
Name: NF2585_high_28
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 1451375 - 1451475
Alignment:
| Q |
1 |
tggtttcatgttacctgcagcggtgatagagtaatccgtgtgtaagttgttatgtcatttttatcagtgattttatgaattttgtcaacgtaatgaattg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1451375 |
tggtttcatgttacatgcagcggtgatagagtaatccgtgtgtaagttgttatgtcatttttatcagtgattttatgaattttgtcaacgtaatgaattg |
1451474 |
T |
|
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
1451475 |
t |
1451475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 1445193 - 1445290
Alignment:
| Q |
1 |
tggtttcatgttacctgcagcggtgatagagtaatccgtgtgtaagttgttatgtcatttttatcagtgattttatgaat-tttgtcaacgtaatgaa |
97 |
Q |
| |
|
||||||||| |||| ||||| |||| |||||||||||| |||||||| ||||||||||||||| | |||||||||||||| |||||||| |||||||| |
|
|
| T |
1445193 |
tggtttcatattacatgcagtggtggtagagtaatccgggtgtaagtcgttatgtcatttttacctgtgattttatgaatctttgtcaatgtaatgaa |
1445290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 249 - 353
Target Start/End: Complemental strand, 5041996 - 5041891
Alignment:
| Q |
249 |
atgttccatcacttcca-cataaaagcctattatttttaccaatatattgcttcttcctactttctatagtgtcattcagtttgtgctattttgcttcat |
347 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5041996 |
atgttccatcacttccaacataaaagcctattttttttaccaatatattgcttcttcctactttctatagtgtcattcagtttgtgctattttgcttcat |
5041897 |
T |
|
| Q |
348 |
ctttta |
353 |
Q |
| |
|
|||||| |
|
|
| T |
5041896 |
ctttta |
5041891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 122 - 188
Target Start/End: Complemental strand, 5042123 - 5042057
Alignment:
| Q |
122 |
tttgtacatataatatatagttttggattattgtttggatagaggctcgtcaaccaaaggagaggta |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042123 |
tttgtacatataatatatagttttggattattgtttggatagaggctcgtcaaccaaaggagaggta |
5042057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University