View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_high_40 (Length: 292)
Name: NF2585_high_40
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 13 - 169
Target Start/End: Original strand, 42329855 - 42330009
Alignment:
| Q |
13 |
aatatggttttctaaaattataaccagccttatgctacaagacgccctctaagtacatatattacgacataaattttgtattttctaataaaaagccata |
112 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
42329855 |
aatatggttttctaaaattataatcagccttatgctacaagactccctctaagtac--atattacgacataaattttgtattttctaat-aaaagccaaa |
42329951 |
T |
 |
| Q |
113 |
tgcatcatattgtattgtaaaaagaaaatgtatacacata-ggataaatgttgaactc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
42329952 |
tgcatcatattgtattgtaaaaagaaaatgtatacacgtagggataaatgttgaactc |
42330009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 199 - 273
Target Start/End: Original strand, 42330025 - 42330099
Alignment:
| Q |
199 |
tatttagttgtctacattgaaatcaagaagaaatctctaaacaaaagttttcaaaactgaaaggtactcaaacct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42330025 |
tatttagttgtctacattgaaatcaagaagaaatctctaaacaaaagttttcaaaactgaaaggtactcaaacct |
42330099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University