View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_high_58 (Length: 209)
Name: NF2585_high_58
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_high_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 167
Target Start/End: Complemental strand, 1173607 - 1173461
Alignment:
| Q |
20 |
tacaatacctatacatcattaatannnnnnnnactatcataccctttactatttattattctatcttctttcaattcttttaagaaaaatgctatataca |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
1173607 |
tacaatacctatacatcattaatattttttttactatcataccctttactatttattattctatcttcttttaatt-ttttaagaaaaatactatataca |
1173509 |
T |
 |
| Q |
120 |
acgaattgattctcgcaggtacatactgaaagagtattccactgggca |
167 |
Q |
| |
|
|| |||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
1173508 |
acaaattgattcttgcgagtacataccgaaagagtattccactgggca |
1173461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 101
Target Start/End: Complemental strand, 32397452 - 32397404
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattctttta |
101 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32397452 |
ctattataaccttaactatttattactctatcttctttcaattctttta |
32397404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 101
Target Start/End: Original strand, 32882220 - 32882268
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattctttta |
101 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32882220 |
ctattataaccttaactatttattactctatcttctttcaattctttta |
32882268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 99
Target Start/End: Complemental strand, 38052468 - 38052427
Alignment:
| Q |
58 |
ataccctttactatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
|||||||| | ||||||||||| ||||||||||||||||||| |
|
|
| T |
38052468 |
atacccttaattatttattattttatcttctttcaattcttt |
38052427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 90
Target Start/End: Original strand, 9012484 - 9012520
Alignment:
| Q |
54 |
tatcataccctttactatttattattctatcttcttt |
90 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |
|
|
| T |
9012484 |
tatcattctctttactatttattattctatcttcttt |
9012520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 101
Target Start/End: Complemental strand, 19807009 - 19806961
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattctttta |
101 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
19807009 |
ctattataaccttaactatttattactctatcttctttcaattatttta |
19806961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 53 - 102
Target Start/End: Complemental strand, 29086637 - 29086588
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattcttttaa |
102 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
29086637 |
ctatcataccctttactatttattgttctctcttctttcaattcttttaa |
29086588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 99
Target Start/End: Complemental strand, 31023772 - 31023726
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
|||| |||||||| ||||||||||||||| |||||||||| |||||| |
|
|
| T |
31023772 |
ctattatacccttaactatttattattctctcttctttcatttcttt |
31023726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 95
Target Start/End: Original strand, 11030142 - 11030179
Alignment:
| Q |
58 |
ataccctttactatttattattctatcttctttcaatt |
95 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
11030142 |
atacccttgactatttattattctctcttctttcaatt |
11030179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 62 - 99
Target Start/End: Original strand, 13352559 - 13352596
Alignment:
| Q |
62 |
cctttactatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
13352559 |
ccttaactatttattactctatcttctttcaattcttt |
13352596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 55 - 102
Target Start/End: Complemental strand, 43248569 - 43248522
Alignment:
| Q |
55 |
atcataccctttactatttattattctatcttctttcaattcttttaa |
102 |
Q |
| |
|
|||||||||||||||||| |||||| | | |||||||||||||||||| |
|
|
| T |
43248569 |
atcataccctttactattaattattttcttttctttcaattcttttaa |
43248522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 99
Target Start/End: Complemental strand, 10198001 - 10197955
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
|||| |||||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
10198001 |
ctattatacccttgactatttattactttatcttctttcaattcttt |
10197955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 99
Target Start/End: Complemental strand, 21134589 - 21134543
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
|||| ||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
21134589 |
ctattataaccttaactatttattattctctcttctttcaattcttt |
21134543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 99
Target Start/End: Original strand, 42521430 - 42521476
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
|||| |||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
42521430 |
ctataatacccttaactatttattactctttcttctttcaattcttt |
42521476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 99
Target Start/End: Complemental strand, 30440573 - 30440532
Alignment:
| Q |
58 |
ataccctttactatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
||||| || ||||||||||||||| ||||||||||||||||| |
|
|
| T |
30440573 |
ataccattaactatttattattctctcttctttcaattcttt |
30440532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 99
Target Start/End: Complemental strand, 24166781 - 24166749
Alignment:
| Q |
67 |
actatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
24166781 |
actatttattattctctcttctttcaattcttt |
24166749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 99
Target Start/End: Original strand, 8050487 - 8050533
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8050487 |
ctattataaccttgactatttattactctatcttctttcaattcttt |
8050533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 99
Target Start/End: Complemental strand, 36302877 - 36302831
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
36302877 |
ctattataaccttaactatttattactctatcttctttcaattcttt |
36302831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 101
Target Start/End: Complemental strand, 6517592 - 6517544
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattctttta |
101 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
6517592 |
ctattatatccttaactatttattactctttcttctttcaattctttta |
6517544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 102
Target Start/End: Complemental strand, 9227893 - 9227857
Alignment:
| Q |
66 |
tactatttattattctatcttctttcaattcttttaa |
102 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
9227893 |
tactatttattattttatcttttttcaattcttttaa |
9227857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 101
Target Start/End: Original strand, 37337124 - 37337172
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattctttta |
101 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
37337124 |
ctattataaccttaactatttattactctatcttctttcaagtctttta |
37337172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 62 - 99
Target Start/End: Complemental strand, 3598815 - 3598778
Alignment:
| Q |
62 |
cctttactatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3598815 |
ccttaactatttattactctatcttctttcaattcttt |
3598778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 99
Target Start/End: Complemental strand, 1513492 - 1513460
Alignment:
| Q |
67 |
actatttattattctatcttctttcaattcttt |
99 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
1513492 |
actatttattactctatcttctttcaattcttt |
1513460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 101
Target Start/End: Original strand, 24524035 - 24524083
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattctttta |
101 |
Q |
| |
|
|||| ||| |||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
24524035 |
ctattataaccttaactatttattactttatcttctttcaattctttta |
24524083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 101
Target Start/End: Original strand, 36652533 - 36652581
Alignment:
| Q |
53 |
ctatcataccctttactatttattattctatcttctttcaattctttta |
101 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
36652533 |
ctattatatccttaactatttattactctttcttctttcaattctttta |
36652581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 54 - 102
Target Start/End: Complemental strand, 25149493 - 25149447
Alignment:
| Q |
54 |
tatcataccctttactatttattattctatcttctttcaattcttttaa |
102 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
25149493 |
tatcataccctttattatttattactct--cttctttcaattcttttaa |
25149447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University