View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_high_59 (Length: 206)
Name: NF2585_high_59
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_high_59 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 42104338 - 42104149
Alignment:
| Q |
17 |
acaatatactagagatagatgtcagtgatgaagagattgaagttgaagatttggagaggcgaatgtggaaggatcgtatcaaactccaaaggctcaagga |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42104338 |
acaatatactggagatagatgtcagtgatgaagagattgaagttgaagatttggagaggcgaatgtggaaggatcgtatcaaactccaaaggctcaagga |
42104239 |
T |
 |
| Q |
117 |
aaaacaaaagcttgcagcacaagaagctgcagagaagcaaaagccaaggcagtctcaggcacaagagaattactcttatatacatgcaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42104238 |
aaaacaaaagcttgcagcacaagaagctgcagagaagcaaaagccaaggcagtctcaggcacaagaaaattactcttatatacatgcaaa |
42104149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 17 - 170
Target Start/End: Complemental strand, 42114710 - 42114557
Alignment:
| Q |
17 |
acaatatactagagatagatgtcagtgatgaagagattgaagttgaagatttggagaggcgaatgtggaaggatcgtatcaaactccaaaggctcaagga |
116 |
Q |
| |
|
||||||| | ||||| |||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42114710 |
acaatattccagagaaagatgtcagtgatgaagagattgaggcagaagatttggagaggcggatgtggaaggatcgtatcaaactcaaaaggctcaagga |
42114611 |
T |
 |
| Q |
117 |
aaaacaaaagcttgcagcacaagaagctgcagagaagcaaaagccaaggcagtc |
170 |
Q |
| |
|
|||||||||||||| ||| || |||| ||||||||||||||| |||||||| |
|
|
| T |
42114610 |
aaaacaaaagcttgaagcgcagaaagccctagagaagcaaaagccgaggcagtc |
42114557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University