View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_high_60 (Length: 206)
Name: NF2585_high_60
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_high_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 2891667 - 2891854
Alignment:
| Q |
1 |
ccaatgatacacgtggagtttgaattcaaaggtgtgggactagaagatgatggtgttgatagaagttgatttgaagtttgatagtaaataagattttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2891667 |
ccaatgatacacgtggagtttgaattcaaaggtgtgggactagaagatgacggtgttgatagaagttgatttgaagtttgatagtacataagattttgat |
2891766 |
T |
 |
| Q |
101 |
tatcagaaccataataattattatagtttgataattgagggatataatcctcctcttttaaggtacttagaccaaacccattattttg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2891767 |
tatcagaaccataataattattatagtttgataattgagggatataatcctcctcttttaagttacttagaccaaacccattattttg |
2891854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University