View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_low_29 (Length: 363)
Name: NF2585_low_29
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_low_29 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0072 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 11 - 341
Target Start/End: Complemental strand, 41980 - 41650
Alignment:
| Q |
11 |
tgtccaagaatatcgtgatagcaataccctgaatttgaccgtggaaccgcatggtgcctttacgagcagaaccgttcaaggcattcagtgacaagtggtg |
110 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980 |
tgtccaacaaaatcgtgatagcaataccctgaatttgactgtggaaccgcatggtgcctttacgagcagaaccgttcaaggcattcagtgacaagtggtg |
41881 |
T |
|
| Q |
111 |
ctcctccgtaacaataggtggtgtttcagggtcagttgatggtgtgatttgcggtggtggtgggtcaggttcttcttcttcttcagtttgaaataagaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41880 |
ctcctccgtaacaataggtggtgtttcagggtcagctgatggtgtgatttgttgtggtggtggttcaggttcttcttcttcttcagtttggaataagaaa |
41781 |
T |
|
| Q |
211 |
taatgacgatttggacatttatgagatatagagaatcgttcatcacaataataacataatcttttttctcttctcagcatcatctcagatctagtgatgt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
41780 |
taatgacgatttggacatttatgagatatagagaatcgttcatcacaataatagcataatcctttttctcttctgagcatcatctcagctctagtgatgt |
41681 |
T |
|
| Q |
311 |
ttttaactgggtggccttttgtgggtaggtt |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41680 |
ttttaactgggtggccttttgtgggtaggtt |
41650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University