View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_low_37 (Length: 323)
Name: NF2585_low_37
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 2 - 164
Target Start/End: Original strand, 37335995 - 37336152
Alignment:
| Q |
2 |
tttagaatcaaattaaaatattttcataatgttaaagttcaaaatttgttataaattttactgttttaaaattaataattgtgaattgaaagtcaaatca |
101 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
37335995 |
tttagaatcaaattaaaatatttgcataatgttaaagttcaaaatttataataaattttaccgttttaaaattaataattgtaaattgaaggtcgaatc- |
37336093 |
T |
 |
| Q |
102 |
tctgatctgtgtcaactaaagtggaggatcatattattttatagaaagatagatattcacctt |
164 |
Q |
| |
|
|| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37336094 |
----atttgtgtcaactaaagtggagtatcatattattttatagaaagatagatattcacctt |
37336152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University