View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_low_48 (Length: 265)
Name: NF2585_low_48
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 660214 - 660017
Alignment:
| Q |
1 |
taggttgttgccaagtcaagcaaaagctatgctt----------tggtgcaaaaacaaacactgatacaatataatgcaggtgtgaaaattgttttccat |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
660214 |
taggttgttgccaagtcaagcaaaagctatgcttccctttgctttggtgcaaaaacaaacactgatacaatataatgcaggtgtgaaaattgttttccat |
660115 |
T |
 |
| Q |
91 |
tatgattagtttgttgtactttctactagaaacaatatttgatggatgcaagaactaaactataatgatgacattgttgttattccatggtgttaaaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
660114 |
tatgattagtttgttgtactttctactagaaacaatatttgatggatgcaagaactaaactataatgatgacattgttgttattccatggtgttaaaa |
660017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 56
Target Start/End: Original strand, 22071542 - 22071593
Alignment:
| Q |
5 |
ttgttgccaagtcaagcaaaagctatgctttggtgcaaaaacaaacactgat |
56 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22071542 |
ttgttgccaagtcgagctgaagctatgctttggtgcaaaaacaaacactgat |
22071593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University