View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2585_low_51 (Length: 252)

Name: NF2585_low_51
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2585_low_51
NF2585_low_51
[»] chr7 (1 HSPs)
chr7 (197-238)||(1972400-1972441)


Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 1972441 - 1972400
Alignment:
197 caatattcctctactaaccaccaagaggcttacatatgaaag 238  Q
    ||||||||||||||||||||||||||||||||||||||||||    
1972441 caatattcctctactaaccaccaagaggcttacatatgaaag 1972400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University