View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_low_53 (Length: 240)
Name: NF2585_low_53
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_low_53 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 152 - 240
Target Start/End: Original strand, 1418893 - 1418982
Alignment:
| Q |
152 |
attttaggtatttctttcacaatgcacattgcctttgacaccatatgactgactatattcatca-caccactccaaccaaggatggtcat |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1418893 |
attttaggtctttctttcacaatgcacattgcctttgacaccatatgactgactatattcatcaccaccactccaaccaaggatggtcat |
1418982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 1418693 - 1418744
Alignment:
| Q |
18 |
catatttgatgaattgttgaaccgacttgaattgtttaaaagctaaaaattg |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1418693 |
catatttgatgaattgttgaaccgacttgaattgtttaaaagctaaaaattg |
1418744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University